Amir, Riaz, Chang, Akhtar, Yoo, Sheikh, and Kashif: Impact of unhygienic conditions during slaughtering and processing on spread of antibiotic resistant Escherichia coli from poultry

Impact of unhygienic conditions during slaughtering and processing on spread of antibiotic resistant Escherichia coli from poultry

Abstract

Antibiotic resistance in Escherichia coli is a global health concern. We studied all possible routes of cross contamination of broiler meat with resistant E. coli from broiler feces at poultry shops. Various sample categories namely poultry feces, meat (n=225 for each), slaughterer hands, consumer hands, slaughterer knife, canister, tap water, carcass, feed and drinking water (n=50 for each) were collected from local poultry processing market. Samples were screened for prevalence of E. coli, resistance of isolates against ten antibiotics and presence of tetracycline- resistance genes in the isolates. Fecal samples had greatest colony count (4.1×104 CFU/g) as compared to meat (1.9×104 CFU/g) samples. Samples of consumer hands (6%) and tap water (12%) had less prevalence percentages of E. coli as compared to slaughterer hands (92%) and drinking water of broiler (86%). Isolates of eight sample categories had high resistant rate (≥90%) against oxytetracycline. On average, about 94% of the isolates from various sample categories possessed multidrug-resistance (MDR). Tetracycline-resistance genes (tetA and tetB) were identified in all sample categories except isolates of consumer hands and tap water. The distribution of tetracycline- resistance genes was significantly greater in fecal isolates (42%) than meat isolates (25%). The study depicted the spread of resistant E. coli in broiler meat through all studied routes of contamination of slaughtering periphery. This problem can be mitigated by strict monitoring of antibiotics use at poultry farms, prevention of cross contamination by adopting hygienic slaughter and vigorously screening the market meat for resistant E. coli.





Introduction

Escherichia coli commonly colonize the gastrointestinal tract of animals and some of its strains instigate gastroenteritis, urinary tract infections and meningitis.1 According to WHO, diarrheal diseases associated with E. coli account for over 4% of the total daily global disease burden and about 1.8 million deaths each year, of which 90% are children.2 Avian Pathogenic Escherichia coli (APEC) in poultry causes colibacillosis, septicemia and cellulitis and it may also link to the extra-intestinal pathogenic E. coli strains in humans. These extra-intestinal pathogenic E. coli strains cause diseases in outside the intestinal tract of humans.3 To control bacterial infections in humans and animals, huge amounts of antibiotics are used. A number of antibiotics like β-lactams and quinolones are commonly recommended for poultry diseases.4,5 In many Asian and African countries, large amounts of antibiotics are frequently added in broiler feed as antimicrobial growth promoters and results in antibiotic resistance.6 Enzymatic degradation of antimicrobial drugs, alteration in bacterial proteins and changes in membrane permeability to antibiotics are mechanisms of development of antibiotic resistance in bacteria. In intensively reared animals, antibiotics are administered to whole flock rather than the individual animal. Therefore, antibiotic selection pressure against resistance in bacteria in broiler is high and their feces are often loaded with antibiotic resistant microbiota.7 In Pakistan, for example, fecal E. coli of food animals were found resistant against many commonly prescribed veterinary medicines.8

At slaughter, resistant strains from gut readily spoil the poultry carcass and consequently, meat is often contaminated with multi-resistant E. coli.9 Antibiotics not only select the pathogenic bacteria for resistance but also induce resistance in microbiota of exposed individuals10 and thus it becomes difficult to treat human ailments.11 Resistant APEC may transfer their resistant genes to humans through food chain and cause complications in the treatment of urinary tract infections.3,12 Resistant fecal E. coli may become part of human intestinal microbiota directly by individual exposure or indirectly via food chain.10 Therefore, resistant E. coli from poultry may contaminate the environment and are disseminated throughout the ecosystem.13 Despite uncontrolled use of antibiotics, particularly in developing countries, at poultry farms and high prevalence rate of antibiotic resistance in E. coli isolates of broiler, there is no latest report on spread of resistant E. coli in the environment.

Tetracycline-resistance genes were identified in E. coli isolates of meat and fecal samples of broiler14 and such resistant genes may spread from poultry feces to humans.10,15 Transfer of CMY-2 AmpC β- lactamase plasmids of E. coli from food animals to humans has also been reported in Iowa, United States.16 Increase in resistance of Gram-negative bacteria is mainly due to presence of mobile genes that may spread through bacterial population. Furthermore, unprecedented human air travel and migration allowed resistant-bacterial plasmids and clones to transport between countries. Owing to transfer of resistant bacteria, antimicrobial resistance has become a major threat to global public health against effective prevention and treatment of an ever-increasing range of infections caused by E. coli.17-19

In many developing countries, including Pakistan, India, Bangladesh, and Afghanistan, more than 90% of human population consumes broiler meat purchased from local poultry processing markets located in open environments of streets, roads and populated areas of cities. Skinning and evisceration are done without taking care of contamination of meat with feces and blood. Unhygienic practices of using unclean knives, dirty containers, and unwashed cutting boards are the possible routes of contamination from poultry feces to poultry meat and surrounding environment. In Pakistan, these poultry shops are the major source of poultry meat.

Keeping in view the unhygienic conditions at the poultry shops, we speculated that these poultry shops might be spreading resistant E. coli originating from broiler feces. The key objective of our study was to evaluate spread of fecal E. coli and its resistance determinants through poultry slaughtering and processing practices adopted at local markets.

Materials and Methods

Sampling

Fecal and meat samples (n=225 each) of broilers were randomly collected from different poultry shops located in four cities (Khanewal, Multan, Dera Ghazi Khan and Bahawalpur) of South Punjab, Pakistan. Not any single bird was specifically sacrificed for this study. Swabbing of slaughterers’ hands, consumers’ hands, slaughtering knives, cutting boards, canisters and broiler carcasses was done (n=50 each) from randomly selected poultry shops. A sterilized swab, premoistened with phosphate buffer saline (PBS), was used for each sample. To cover maximum area, the swab was rolled three times for each sample. Each swab was dipped and vortexed in 5 mL of brain heart fusion broth for 10 s.20

Samples of broiler feeds and drinking water were also randomly collected from these poultry processing shops. Swabbing of consumer’s hands was done before their entrance to the poultry shops (as mentioned above) and samples of tap water (unfiltered and untreated) were collected after running the tap for five minutes. Collected samples were placed in sterile plastic bags and stored at 4°C until further experimentation. All the chemicals and materials used in this study were purchased from Oxoid (UK) or Sigma- Aldrich (USA).

Isolation and colony counts

For isolation of E.coli, fecal, meat and feed samples were homogenized in Butterfield’s phosphate-buffered water. The diluted blends and water samples (tap/drinking) were inoculated in Lauryl Tryptose Soya (LTS) broth following incubation.21 All swabs were separately enriched in Lauryl Tryptose Soya (LTS) broth. Positive samples from LTS broth were identified with gas production and transferred on Levine’s Eosin Methylene Blue (L-EMB) agar.22 Dark centered and flat colonies with or without metallic sheen were isolated and confirmed as E. coli by IMViC and sugar biochemical reactions. Colonies of E. coli were counted and reported in CFU/ml, CFU/g or CFU/cm2.

Antibiotic resistance

Antimicrobial resistance pattern of isolated E. coli strains were carried out with disk diffusion method on Mueller Hinton agar.23 Ten drugs belonging to eight antimicrobial categories [1st generation cephalosporins (cephradine), 3rd generation cephalosporins (ceftriaxone), phenicols (chloramaphenicol), aminoglycosides (gentamycin), quinolone/ flouroquinolone (nalidixic acid, ciprofloxacin), penicillin (penicillin, amoxicillin), tetracycline (oxytetracycline) and macrolides (azithromycin)] were used in this study. Results on E. coli isolates were classified to sensitive and resistant groups. Antibiotic control strain E. coli ATCC 25922 was used for standardization.24

Resistant isolates were further classified to possible multi-drug resistant (MDR), confirmed MDR, possible extensively-drug resistant (XDR) and possible pandrug resistant (PDR).25 Possible MDR isolates were resistant to at least one drug in less than three out of the used eight antimicrobial categories. Confirmed MDR isolates were resistant to at least one drug in at least three antimicrobial categories. Any confirmed MDR isolate that was resistant to one drug in all but less than or equal to two antimicrobial categories was named as possible XDR and a possible XDR isolate resistant to all the used ten drugs was named as possible PDR.

Tetracycline-resistance genes

All tetracycline-resistant isolates were further observed for presence of tetracyclineresistance genes through PCR. Bacterial genomic DNA was extracted by method of Seidavi et al.26 and confirmed by 16s rRNA gene using oligonucleotide primers ECO-F GACCTCGGTTTAGTTCACAGA and ECO-R CACACGCTGACGCTGACCA with product size 585bp.27Moreover, tetracycline resistant genes (tetA and tetB) were amplified with primers tetA-F GGTTCACTCGAACGACGTCA, tetA-R CTGTCCGACAAGTTGCATGA, tetB-F CCTCAGCTTCTCAACGCGTG and tetB-R GCACCTTGCTGATGACTCTT.28 PCR reactions were carried out in total volume of 25 μl containing 5 μL DNA, 2.5 μL buffer × 10, 2 μL MgCl2, 5 μL dNTP mix, 0.25 μL of each primer and 0.2 μL Taq polymerase.29 Denaturation process were carried out at 95°C for 5 min and amplification was performed at 94°C for 60 s, 50°C for 45 s, and extension at 72°C for 90 s, with further extension at 72°C for 300 s. PCR products were analyzed by electrophoresis in 1.5% agarose gel and stained by ethidium bromide.

Statistical analysis

Association of prevalence of E. coli and antibiotic resistance with sample categories was estimated by employing Chi-square (χ2) test on SPSS version 21 (IBM Corporation, USA).

Results

Prevalence percentage and colony Counts

Greater than 80% isolates of all sample categories had E. coli except that of consumer hands (6%) and tap water (12%) (Table 1). All collected samples of feces, meat, canister and carcass were 100% positive for E. coli. Prevalence percentage of E. coli in samples of slaughterer hand, knife and cutting board was statistically similar (about 92%).

Observed load of E. coli was more than double in broiler feces (4.1×104 CFU/g) than meat (1.9×104 CFU/g) samples (Figure 1). Drinking water of broiler had about six times more E. coli load than tap water (1.5×102 CFU/mL). Similarly, slaughterer hands (1.4×104 CFU/cm2) had much greater load of E. coli than on consumer hands (11 CFU/cm2).

Antibiotic resistance and MDR

In present study, antibiotic resistance of E. coli isolates from all sample categories against the 10 antibiotics ranged from 0 to 100% (Table 2). Most E. coli isolates from feces, meat, carcass and canister were resistant against eight antibiotics. Surprisingly, level of resistance against oxytetracycline was >80% in all sample categories except samples of consumer hands (0%), tap water (4%) and drinking water (20%). Comparing the results of resistance of feces and meat, significant (P<0.05) difference in antibiotic resistance against gentamycin, nalidixic acid, penicillin, cephradine, amoxicillin, azithromycin and ciprofloxacin was found. E. coli isolates from consumer hands were completely sensitive to all antibiotics while isolates from tap water showed minimum resistance against the tested drugs. Majority of isolates from all sample categories were sensitive against ceftriaxone except isolates of feces and cutting board.

All isolates from slaughterer hands and knife were susceptible to azithromycin (100%) and no significant difference was observed for ceftriaxone, gentamycin, penicillin, cephradine, oxytetracycline and ciprofloxacin for both sample categories.

On average, about 94% of the isolates from various sample categories were resistant to one or more of the drugs from ≥3 antimicrobial categories tested. Alarmingly, 51 isolates from broiler feces and 24 isolates from broiler meat were resistant to all drugs except two and were classified as possible XDR. Moreover, 4 isolates from broiler feces and 1 isolate from canister were completely resistant to all the drugs tested.

Tetracycline-resistance genes

PCR products for tetracycline-resistance genes were obtained for 95 faecal, 57 meat, 6 slaughterer hand, 7 slaughterer knife, 6 cutting board, 5 canister, 7 carcass, 8 feed and 2 drinking water isolates (Table 3). For all sample categories, prevalence percentage of genotypic results of tetracycline-resistance was lower than results of phenotypic percentage. The positive rate of tetA was greater in feces (44%) while almost same prevalence percentage for tetA and tetB was observed in all sample categories. Study demonstrated presence of tetA, tetB and tetA+tetB in all sample categories except in isolates of consumer hands and tap water.

Discussion

Escherichia coli is the commensal bacterium and reside in the gut of animals including broiler.30 Similar to this study (Figure 1, Table 1), greater prevalence of E. coli in poultry feces was observed in previous study as compared to other sample categories. 10 Contaminated poultry feed and water are major sources of E. coli for broiler. 31,32 Prevalence of E. coli in drinking water (86%) and feed (84%) at poultry shops (Figure 1, Table 1) was greater than reported in water (19%) and feed (35%) samples of broiler farms.31-33 This is probably because of contamination of feed and water pots with broiler feces at poultry shops. Amin et al.34 observed E. coli in about 8% samples of tap water of Pakistan that was in line to present study (Table 1). At poultry shops, tap water is used for the washing of utensils, tables, cutting knives, and hands. Relatively lesser E. coli load in tap water means that it was not the major source of high E. coli prevalence in various samples collected from slaughtering and processing markets.

During slaughtering, carcass of poultry may be contaminated with the gut contents from which E. coli may spilled out as a contaminant. Seidavi and collaeuges,26 found that 88%, 38% and 25% samples respectively of cecum, ileum and duodenum (gut contents) yielded E. coli in healthy broiler chickens. Feces of broiler, gut contents and carcass of bird are considerably major sources of contamination of meat. High prevalence percentage of E. coli in meat (100%) was in line to study of India (98%) while higher than of Morroco (48%), Washington (39%) and Bangkok (25%).35-38 Presence of E. coli in meat poses serious health issues for consumers at large. Extremely high prevalence rate pinpointed precarious and dangerous unhygienic conditions of slaughtering at retail butcher shops.

We assumed that the screening and then colonization under selection of antibiotics from extraneous sources resulted in resistant E. coli colonization of the chicken gut. Work on poultry showed the presence of different antibiotics in reasonable amounts that could select E. coli transferred to poultry meat.39 Resistant bacteria from feces of bird may spread to meat40 and possibly to surrounding periphery. In most categories of samples, resistant E. coli were detected (Table 2). Resistance in broiler E. coli might have been developed due to extensive use of antibiotics at poultry farms.41,42 Majority of isolates from all sample categories were resistant to oxytetracycline (Table 2). Tetracycline resistant E. coli isolates from poultry meat, feces, water, carcass and poultry products was also examined in a number of previous studies.15,30,33,43,44 Elevated level of tetracycline resistance might suggest widespread and extensive use of tetracycline at poultry farms.10 Tetracycline is the first line drug used for prophylaxis and for growth promotion of livestock.45 Determined resistance of E. coli against oxytetracycline (84%) in poultry feed was much higher than the study of Portugal that showed maximum resistance of 41% against tetracycline.39 These differences in antibiotic resistance in E. coli among previous and the present studies might be due to the differences in purity, dosage, price, laws, access, availability and awareness regarding usage of antibiotics in different regions.46 In Switzerland, for example, where usage of antibiotic is monitored by the government agencies, low levels of antibiotic resistance against cephalosporins were observed in isolates of poultry faeces.47Quinolone is next to tetracycline that is commonly used at clinical sites.48 Frequency of resistance in Escherichia coli isolated from meat and faecal samples (63-72%) to nalidixic acid (Table 2) was lesser than findings of Miles15 who reported 85% resistance of nalidixic acid against E. coli. Greater resistance level of E. coli isolates against first generation cephradine (Table 2) suggested that the presence and routine use of antibiotics. This exerts selective pressure in poultry farms, allowing Cephradine-resistant pathogenic E. coli strains to dominate the intestinal microbiota of the birds. Compared with other drugs used in this and a previous study,49 sensitivity of E. coli isolates to ceftriaxone in poultry meat perhaps was due to low usage of this antibiotic at broiler farms. Complete resistance (100%) for two drugs importantly in fecal samples indicated routine use of these antibiotics in animal feed again driven up penicillin, tetracycline, quinolones and fluoroquinolone resistance rates. In present study, isolates exhibited alarmingly higher multi-drug resistance (Table 4). Prevalence of such highly resistant isolates poses a challenge not only for poultry industry but also in ailment of humans. Observed MDR, XDR and PDR probably evolved through excessive usage of multiple antibiotics in poultry for growth promoters and therapeutic purposes- a practice that needs to be modified greatly if poultry farmers want to control spread of pathogenic E. coli.

Reports on dissemination and amplification of resistant genes including that for tetracycline-resistant genes in the environment are available.50 Detection of tetA and tetB genes carried by all studied groups except control groups of consumer hands and tap water (Table 3) demonstrated the distribution of similar resistant determinants in diverse genetic background. This probably indicated the continuous exposure to tetracycline resulted in high percentage of tetracycline-resistant E. coli and these isolates may have diversity of resistance genes. Presence of tetracycline-resistance genes in above mentioned sample categories showed significant level of crossresistance among all routes relevant to broiler meat. This study was in agreement to the results of Miles et al.15 who determined tetracycline-resistance in diverse genetic background. This elevated level of dissemination of tetA and tetB genes in present study suggested limited therapeutic options for broiler colonized with tetracycline- resistant E. coli. It has already been documented that indiscriminate usage of antimicrobial agents in poultry industry had led to dissemination of antibiotic resistant genes from poultry to humans.40 It is further suggested that colonization of these resistant species will effect human gastrointestinal microbiota by transfer of their plasmids to endogenous microbiota.10 Therapeutic use of drugs, such as quinolones, in animal feed had resulted in resistance in Enterobacter species in humans.51 Therefore, in-feed antibiotics must be replaced with suitable alternatives.52

Conclusions

Prevalence of resistant E. coli in most sample categories clearly depicted the level of cross contamination of broiler meat from different routes during slaughtering and processing practices. Greater resistant isolates from all sample categories, specifically in feces and meat, against most antibiotics presented an alarming situation. Spread of tetracycline-resistance genes may precariously depict broiler meat as a danger for human health. These resistant determinants of E. coli may not only pose threat for slaughterers but also confront several risks to control most common diarrheal outbreaks in southern Punjab, Pakistan and similar areas. Greater MDR isolates revealed the possibility of indiscriminate use of antibiotics at poultry farms. For the provision of safe and healthy protein source for humans, regulatory authorities must strictly govern the use of antibiotics at poultry farms. There is a dire need to educate poultry farmers for the use of only permitted antibiotics within the recommended dosage. Moreover, slaughterers must be educated how to prevent cross contamination and adopt hygienic practices during slaughtering and processing of chicken meat for sale to prevail the situation. Contaminated raw meat loaded resistant E. coli is unfit for human consumption until proper cooking. To control disease burden, therefore, there is dire need to vigorously screen broiler meet for resistant E. coli.

Acknowledgements

The study was funded by Bahauddin Zakariya University, Multan, Pakistan.

References

1. 

K Todar. Todar’s online textbook of bacteriology. Available from: www.textbookofbacteriology.net">www.textbookofbacteriology.net. Accessed on December 2016.

2. 

WHO. The World Medicines Situation. Geneva, Switzerland: World Health Organization; 2004.

3. 

AS Obeng, H Rickard, O Ndi. Antibiotic resistance, phylogenetic grouping and virulence potential of Escherichia coli isolated from the faeces of intensively farmed and free range poultry. Vet Microbiol 2012;154:305-15.

4. 

X Cao, LM Cavaco, Y Lv. Molecular characterization and antimicrobial susceptibility testing of Escherichia coli isolates from patients with urinary tract infections in 20 Chinese Hospitals. J Clin Microbiol 2011;49:2496-501.

5. 

F Cetinkaya, A Yibar, GE Soyutemiz. Determination of tetracycline residues in chicken meat by liquid chromatographytandem mass spectrometry. Food Addit Contam Part B 2012;5:45-9.

6. 

W Witte, I Klare, G. Werner Selective pressure by antibiotics as feed additives. Infection 1999;27:35-8.

7. 

Bogaard AE Van den, EE Stobberingh. Antibiotic usage in animals: impact on bacterial resistance and public health. Drugs 1999;58:589-607.

8. 

M Idrees, MA Shah, S Michael. Antimicrobial resistant Escherichia coli strains isolated from food animals in Pakistan. Pak J Zool 2011;43:303-10.

9. 

EC Dancla, J. Lafont IncH plasmids in Escherichia coli strains isolated from broiler chicken carcasses. Appl Environ Microbiol 1985;49:1016-8.

10. 

Bogaard AE Van den, N London, C Driessen, EE Stobberingh. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J Antimicrob Chemother 2001;47:763-71.

11. 

JR Johnson, MA Kuskowski, K Smith. Antimicrobial-resistant and extraintestinal pathogenic Escherichia coli in retail foods. J Infect Dis 2005;191:1040-9.

12. 

H Sørum, M. Sunde Resistance to antibiotics in the normal flora of animals. Vet Res 2001;32:227-41.

13. 

ZA Memish, S Venkatesh, AM Shibl. Impact of travel on international spread of antimicrobial resistance. Int J Antimicrob Agents 2003;21:135-42.

14. 

T Zhang, CG Wang, JC Lv. Survey on tetracycline resistance and antibioticresistant genotype of avian Escherichia coli in North China. Poult Sci 2012;91:2774-7.

15. 

T Miles, W McLaughlin, P. Brown Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet Res 2006;2:2-7.

16. 

PL Winokur, DL Vonstein, LJ Hoffman. Evidence for transfer of CMY-2 AmpC-Lactamase plasmids between Escherichia coli and Salmonella isolates from food animals and humans. Antimicrob Agents Chemother 2001;45:2716-22.

17. 

WHO. Worldwide country situation analysis: response to antimicrobial resistance. Geneva: World Health Organization; 2015.

18. 

PM Hawkey, AM Jones, B Birmingham. The changing epidemiology of resistance. J Antimicrob Chemother 2009;64:i3-i10.

19. 

T Walsh. Combinatorial genetic evolution of multiresistance. Curr Opin Microbiol 2006;9:476-82.

20. 

KA Thom, T Howard, S Sembajwe. Comparison of swab and sponge methodologies for identification of Acinetobacter baumannii from the hospital environment. J Clin Microbiol 2012;50:2140-1.

21. 

P Feng, DS Weagant eds Enumeration of Escherichia coli and the Coliform Bacteria. In: Bacteriological Analytical Manual. New Hampshire, USA: U.S. Food and Drug Administration; 2015.

22. 

P Tille. Bailey & Scott’s Diagnostic Microbiology. 13th ed. St. Louis, USA: Elsevier Health Sciences; 2013.

23. 

CLSI. M100-S24 Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement. Wayne, PA, USA: Clinical and Laboratory Standards Institute; 2014.

24. 

P Knezevic, O. Petrovic Antibiotic resistance of commensal Escherichia coli of food-producing animals from three Vojvodinian farms, Serbia. Int J Antimicrob Agents 2008;31:360-3.

25. 

AP Magiorakos, A Srinivasan, RB Carey. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268-81.

26. 

A Seidavi, SZ Mirhosseini, M Shivazad. Detection and investigation of Escherichia coli in contents of duodenum, jejunum, ileum and cecum of broilers at different ages by PCR. Asia Pacific J Mol Biol Biotechnol 2010;18:321-6.

27. 

U Candrian, B Furrer, C Hofelein. Detection of Escherichia coli and identification of enterotoxigenic strains by primer- directed enzymatic amplification of specific DNA sequences. Int J Food Microbiol 1991;12:339-51.

28. 

L Randall, S Cooles, M Osborn. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five sero- types of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemo Ther 2004;53:208-16.

29. 

M Furushita, T Shiba, T Maeda. Similarity of tetracycline resistance genes isolated from fish farm bacteria to those from clinical isolates similarity of tetracycline resistance genes isolated from fish farm bacteria to those from clinical isolates. Appl Environment Microbiol 2003;69:5336-42.

30. 

BA Sackey, P Mensah, E Collison, Dawson E Sakyi-. Campylobacter, Salmonella, Shigella and Escherichia coli in live and dressed poultry from metropolitan Accra. Int J Food Microbiol 2001;71:21-8.

31. 

M Islam, M Islam, M. Fakhruzzaman Isolation and identification of Escherichia coli and Salmonella from poultry litter and feed. Int J Nat Soc Sci 2014;1:1-7.

32. 

Amaral L do. Drinking water as a risk factor to poultry health. Rev Bras Ciência Avícola 2004;6:191-9.

33. 

V Karimi, TZ Salehi, M Sadegh, S. Jaafarnejad The relation of water contamination and colibacillosis occurrence in poultry farms in Qom province of Iran. Iran J Vet Res 2011;12:133-8.

34. 

S Amin, FE Abdulla, G. Usman Bacterial analysis and antimicrobial susceptibility of bacteria found in different water sources in Karachi. Pakistan J Med Dent 2014;3:62-7.

35. 

P Saikia, S. Joshi Retail market poultry meats of North-East India – a microbiological survey for pathogenic contaminants. Res J Microbiol 2010;5:36-43.

36. 

N Cohen, H Ennaji, B Bouchrif. Comparative study of microbiological quality of raw poultry meat at various seasons and for different slaughtering processes in Casablanca (Morocco). J Appl Poult Res 2007;16:502-8.

37. 

A Akbar, U Sitara, SA Khan. Presence of Escherichia coli in poultry meat: a potential food safety threat. Int Food Res J 2014;21:941-5.

38. 

DG White, S Zhao, R Sudler. The isolation of antibiotic-resistant salmonella from retail ground meats. N Engl J Med 2001;345:1147-54.

39. 

PM da Costa, M Oliveira, A Bica. Antimicrobial resistance in Enterococcus spp. and Escherichia coli isolated from poultry feed and feed ingredients. Vet Microbiol 2007;120:122-31.

40. 

SB Levy, GB Fitzgerald, AB Macone. Spread of antibiotic-resistant plasmids from chicken to chicken and from chicken to man. Nature 1976;260:40-2.

41. 

HJ Barnes, LK Nolan, JP Vaillancourt. Colibacillosis. In: YM Saif, ed. Diseases of Poultry. 12th ed. Oxford, UK: Blackwell Publishing Ltd; 2008. pp 691-737.

42. 

TW Alexander, LJ Yanke, E Topp. Effect of subtherapeutic administration of antibiotics on the prevalence of antibioticresistant Escherichia coli bacteria in feedlot cattle. Appl Environ Microbiol 2008;74:4405-16.

43. 

T Rafiei, A. Nasirian Isolation, identification and antimicrobial resistance patterns of E. coli isolated from chicken flocks. Iran J Pharm Ther 2003;2:39-42.

44. 

RS Sayah, JB Kaneene, Y Johnson. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtained from domestic- and wild-animal faecal samples, human septage, and surface water. Appl Environmantal Microbiol 2005;71:1394-404.

45. 

S Giguère, JF Prescott, PM Dowling, Eds. Antimicrobial therapy in veterinary medicine. 5th ed. New Jersey, USA: John Wiley & Sons, Inc.; 2013.

46. 

JH Liu, SY Wei, JY Ma. Detection and characterisation of CTX-M and CMY- 2 β-lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China. Int J Antimicrob Agents 2007;29:576-81.

47. 

R Lanz, K Peter, B. Patrick Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet Microbiol 2003;91:73-84.

48. 

GG Zhanel, JA Karlowsky, GKM Harding. A Canadian national surveillance study of urinary tract isolates from outpatients: comparison of the activities of trimethoprim- sulfamethoxazole, ampicillin, mecillinam, nitrofurantoin, and ciprofloxacin. The Canadian Urinary Isolate Study Group. Antimic. Antimicrob Agents Chemother 2000;44:1089-92.

49. 

T Lei, W Tian, L He. Antimicrobial resistance in Escherichia coli isolates from food animals, animal food products and companion animals in China. Vet Microbiol 2010;146:85-9.

50. 

RP Adhikari, KC Kalpana, P Shears, AP Sharma. Antibiotic resistance conferred by conjugative plasmid in Escherichia coli isolated from community ponds of Katmandu Valley. J Heal Popul Nutr 2000;18:57-9.

51. 

YH Xiao, J Wang, Y. Li Bacterial resistance surveillance in China: a report from Mohnarin 2004-2005. Eur J Clin Microbiol Infect Dis 2008;27:697-708.

52. 

Y Yang, PA Iji, M. Choct Dietary modulation of gut microflora in broiler chickens: a review of the role of six kinds of alternatives to in-feed antibiotics. Worlds Poult Sci J 2009;65:97-114.

Figure 1.

Colony count of Escherichia coli in broiler faeces (n=225), meat (n=225), slaughterer hands (n=50), consumer hands (n=50), slaughtering knife (n=50), cutting board (n=50), carcass (n=50), tap water (n=50), canister (n=50), feed (n=50) and drinking water (n=50). Error bars are of standard deviation.

mr-8-2-7330-g001.jpg
Table 1.

Prevalence of E. coli in different categories of samples taken from poultry shops in Pakistan.

Sample categories N. samples Observed counts (%)
Broiler feces 225 225a (100)
Broiler meat 225 225a (100)
Slaughterer hands 50 46b (92)
Consumer hands 50 3c (6)
Slaughtering knife 50 46b (92)
Cutting board 50 46b (92)
Canister 50 50b (100)
Broiler carcass 50 50b (100)
Tap water 50 6c (12)
Broiler feed 50 42b (84)
Drinking water of broiler 50 43b (86)

[i] a,b,c,dEach superscript letter denotes a subset of sample categories whose column proportions do not differ significantly from each other at α=0.05. For all categories, zero cells (0%) have expected count less than 5.

Table 2.

Antibiotics resistance in E. coli isolated from different categories of samples taken from poultry shops in Pakistan.

Antibiotics Faeces Meat Slaughterer hands Consumer hands Slaughtering knife Cutting board Container Carcass Tap water Feed water Drinking
(n=225) (n=225) (n=46) (n=2) (n=46) (n=46) (n=50) (n=50) (n=6) (n=42) (n=43)
Ceftriaxone 31b 10d 4d 0e 6d 39a 26bc 20bc 3d 7d 3d
Chloramphenicol 130a 123a 8d 0e 30b 32b 34b 37b 2d 18c 6d
Gentamycin 164a 104b 14d 0f 16e 28d 20d 36c 3f 23d 18de
Nalidixic acid 163a 141b 27cd 0e 31c 32c 36c 36c 5e 22cd 21cd
Penicillin 225a 138b 20c 0e 19c 17c 26c 18c 1a 17c 8d
Cephradine 165a 126b 13c 0f 12c 22c 22c 24c 2e 17c 11d
Amoxycillin 138a 110b 20c 0e 18cd 26c 33c 26c 3d 11d 7d
Azithromycin 106a 73b 0e 0e 0e 12d 21c 24c 0e 8d 4de
Oxytetracycline 225a 222a 44b 0d 43d 42b 45b 47b 2cd 41b 10c
Ciprofloxacin 192a 135b 23d 0e 23d 25d 39c 26d 3e 32cd 17d

[i] a,b,c,d,e,fEach superscript letter denotes a subset of sample categories whose column proportions do not differ significantly from each other at α=0.05. For all categories zero cells (0%) have expected count less than 5.

Table 3.

Distribution percentages of tetracycline-resistance genes in different categories of samples taken from poultry shops in Pakistan.

Samples categories Total confirmed E. coli isolates (n) tetA (%) tetB (%) tetA+tetB (%)
Broiler feces 225 44 42 42
Broiler meat 225 27 25 25
Slaughterer hands 46 20 13 13
Consumer hands 2 0 0 0
Slaughtering knife 46 15 15 15
Cutting board 46 13 13 13
Canister 50 13 10 10
Broiler carcass 50 14 14 10
Tap water 6 0 0 0
Broiler feed 42 19 19 19
Drinking water of broiler 43 5 5 5
Table 4.

Distribution of multidrug resistant (MDR), extensively drug-resistant (XDR) and pandrug-resistant (PDR) Escherichia coli in various sample types.

Sample type N. Possible MDR Confirmed MDR Possible XDR Possible PDR
Broiler faeces 225 1 224 51 4
Broiler meat 225 10 215 24 0
Slaughterer hands 46 7 39 0 0
Consumer hands 2 2 0 0 0
Slaughtering knife 46 6 40 3 0
Cutting board 46 0 46 11 0
Canister 50 1 49 9 1
Broiler carcass 50 1 49 9 0
Tap water 6 1 5 1 0
Broiler feed 42 7 35 1 0
Drinking water of broiler 43 26 17 0 0
Total 1006 63 943 160 9
Abstract views:
478

Views:
PDF
105
HTML
109

Article Metrics

Metrics Loading ...

Metrics powered by PLOS ALM




Copyright (c) 2017 Mamoona Amir, Muhammad Riaz, Yung-Fu Chang, Saeed Akhtar, Sang Ho Yoo, Ahsan Sattar Sheikh, Muhammad Kashif

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
 
© PAGEPress 2008-2018     -     PAGEPress is a registered trademark property of PAGEPress srl, Italy.     -     VAT: IT02125780185     •     Privacy